View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_high_14 (Length: 283)
Name: NF0255_high_14
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0255_high_14 |
 |  |
|
[»] chr1 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 78 - 283
Target Start/End: Complemental strand, 2288619 - 2288414
Alignment:
Q |
78 |
tggacgttaccaaaagacaatggttgcattcctgatggtactataatttgcagaacaactaagcacactctctccgtaagatatggagcaaatgatctta |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2288619 |
tggacgttaccaaaagacaatggttgcattcctgatggtactataatttgcagaacaactaagcacactctctccgtaagatatggagcaaatgatctta |
2288520 |
T |
 |
Q |
178 |
tttgtggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactatgttttatgctttttgattaagcttgat |
277 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2288519 |
tttgtggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactatgttttatgctttttgattaagcttgat |
2288420 |
T |
 |
Q |
278 |
tatgcc |
283 |
Q |
|
|
|||||| |
|
|
T |
2288419 |
tatgcc |
2288414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 250
Target Start/End: Complemental strand, 670502 - 670434
Alignment:
Q |
182 |
tggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactat |
250 |
Q |
|
|
||||||| ||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
670502 |
tggatgggttgctagagcctagaggtctattagattacatgctttccagttttctaattaaagaactat |
670434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 253 - 283
Target Start/End: Complemental strand, 2288378 - 2288348
Alignment:
Q |
253 |
tttatgctttttgattaagcttgattatgcc |
283 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2288378 |
tttatgctttttgattaagcttgattatgcc |
2288348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 114
Target Start/End: Complemental strand, 14470304 - 14470270
Alignment:
Q |
80 |
gacgttaccaaaagacaatggttgcattcctgatg |
114 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |
|
|
T |
14470304 |
gacgttaccaaaagacaatggttgcattcttgatg |
14470270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 670653 - 670612
Alignment:
Q |
30 |
actcccgttcatttttattatgaatgaactatttaaagtggg |
71 |
Q |
|
|
||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
T |
670653 |
actccagttcgtttttataatgaatgaactatttaaagtggg |
670612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 135
Target Start/End: Complemental strand, 670579 - 670535
Alignment:
Q |
91 |
aagacaatggttgcattcctgatggtactataatttgcagaacaa |
135 |
Q |
|
|
|||||||||||| ||||||| |||| ||||||| ||||||||||| |
|
|
T |
670579 |
aagacaatggttacattccttatggaactataacttgcagaacaa |
670535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University