View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_high_15 (Length: 283)
Name: NF0255_high_15
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 31 - 255
Target Start/End: Original strand, 40662619 - 40662843
Alignment:
| Q |
31 |
gtgagatgaaagtctagttttcaaaaccgtatgacaaagcacgaatcatgtgtggtttgactgctttctaacccnnnnnnnctctgccgtcttagtctct |
130 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
40662619 |
gtgaaatgaaagtctagttttcaaaaccgtatgacaaagcacgaatcatgtgtggtttgactgctttctaaccctttttttctctgccgtctttgtctct |
40662718 |
T |
 |
| Q |
131 |
cattagtcattttctcttctctactctcacgacaatcttcattcttgttcttgacattgttcaaacttcaaacaacataacaaactatttatagagtttg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40662719 |
cattagtcattttctcttctctactctcacgacaatcttcattcttgttcttgacattgttcaaacttcaaacaacataacaaactatttatagagtttg |
40662818 |
T |
 |
| Q |
231 |
acattttcagtcaactaaactttat |
255 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40662819 |
acattttcagtcaactaaactttat |
40662843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University