View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_14 (Length: 348)
Name: NF0255_low_14
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 98 - 257
Target Start/End: Original strand, 9411866 - 9412019
Alignment:
| Q |
98 |
aaaactcataagccaaaatccagtatctatatctatctcagtaccctacaccctagaaccatatccattaccatttgttccattcaatacttgcaacttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
9411866 |
aaaactcataagccaaaatccagtatctatatctatctcagtatcctacaccctagaaccatatccattaccatttgttccattcattccttgcaacttg |
9411965 |
T |
 |
| Q |
198 |
ttctctgatttcttcctcttgatcacaatgtcaatgatccatgtgtaagcttccaaaagt |
257 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9411966 |
ttctctgatttcttcctcttgatca------caatgatccatgtgtaagcttccaaaagt |
9412019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University