View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_16 (Length: 331)
Name: NF0255_low_16
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 96 - 318
Target Start/End: Original strand, 13271044 - 13271266
Alignment:
| Q |
96 |
ataaaagattcacattctctatgattgatctctgatggacatcagtatattcgctgaacatctcaaatcctcccatcatcatatagttgccaaattgttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13271044 |
ataaaagattcacattctctatgattgacctctgatggacatcagtatattcactcgacatctcaaatgctcccatcatcatatagttgccaaattgttc |
13271143 |
T |
|
| Q |
196 |
caaaacatttccaccttcacttggtgtagcaagatgcaattcaagatattcttcaatttgctgcttattaacacttccaacattatcacttctttcaggt |
295 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271144 |
caaaacaattccactttcagttggtgtagcaagattcaattcaagatattcttcaatttgctgcttattaacacttccaacattatcacttctttcaggt |
13271243 |
T |
|
| Q |
296 |
ggcgatttcattttgtacccttc |
318 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
13271244 |
ggcgatttcattttgtactcttc |
13271266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1144 times since January 2019
Visitors: 2572