View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_18 (Length: 321)
Name: NF0255_low_18
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 98 - 321
Target Start/End: Original strand, 43332244 - 43332467
Alignment:
| Q |
98 |
atgtcatgcaagaagtgattgagatttaggttcaattatactaactctaacaatacgatcggagaaacacacaataacttcacatgatatacatttacaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43332244 |
atgtcatgcaagaagtgattgagatttaggttcaattatactaactcgaacaatacgatcggagaaacacacaataacttcacatgatatacatttacaa |
43332343 |
T |
|
| Q |
198 |
tatcaattattattatatagacatggatcaagaatatgtatacatttgaaaatttacgagacaaccgatgagagaacaacaatgagagactgaactaccc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43332344 |
tatcaattattattatatagacatggatcaagaatatgtatacatttgaaaatttacgagacaaccgatgagagaacaacaatgacagactgaactaccc |
43332443 |
T |
|
| Q |
298 |
tcatcatcgtctatgtttacaaat |
321 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43332444 |
tcatcatcgtctatgtttacaaat |
43332467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1269 times since January 2019
Visitors: 2574