View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_22 (Length: 315)
Name: NF0255_low_22
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_22 |
 | |
|
| [»] scaffold0096 (1 HSPs) |
| | |
|
| [»] scaffold0246 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0096 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 78 - 222
Target Start/End: Original strand, 28955 - 29099
Alignment:
| Q |
78 |
gaatggaagggtttattattttactgaatgatgggcttcaatgaaggattattataatatcctaggatgctcttggatcactctcatatatgcaaatcgc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28955 |
gaatggaagggtttattattttactgaatgatgggctttaatgaaggattattataatatcctaggatgctcttggatcactctcatatatgcaaatcgc |
29054 |
T |
|
| Q |
178 |
ttcctctttctctttcgcggcgttacttggaaagaagaagaattt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29055 |
ttcctctttctctttcgcggcgttacttggaaagaagaagaattt |
29099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 78 - 222
Target Start/End: Complemental strand, 12537627 - 12537483
Alignment:
| Q |
78 |
gaatggaagggtttattattttactgaatgatgggcttcaatgaaggattattataatatcctaggatgctcttggatcactctcatatatgcaaatcgc |
177 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12537627 |
gaatggaagggtttattattttactgatggatgggcttcaatgaaggattattataatatcctaggatgctcttggatcactctcatatatgcaaatcgc |
12537528 |
T |
|
| Q |
178 |
ttcctctttctctttcgcggcgttacttggaaagaagaagaattt |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12537527 |
ttcctctttctctttcgcggcgttactaggaaagaagaagaattt |
12537483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 94 - 213
Target Start/End: Original strand, 13231 - 13350
Alignment:
| Q |
94 |
tattttactgaatgatgggcttcaatgaaggattattataatatcctaggatgctcttggatcactctcatatatgcaaatcgcttcctctttctctttc |
193 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||| ||||| ||| | ||||| ||||| ||| | ||||||||||||||| ||| |||||||||| |
|
|
| T |
13231 |
tatttcactgatggatgggctacaatgaaggatttttatatcatcactgcttgctcatggatgactgtgatatatgcaaatcgcaacctatttctctttc |
13330 |
T |
|
| Q |
194 |
gcggcgttacttggaaagaa |
213 |
Q |
| |
|
| || |||||| |||||||| |
|
|
| T |
13331 |
gtggagttactaggaaagaa |
13350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University