View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_23 (Length: 315)
Name: NF0255_low_23
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0255_low_23 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 94 - 315
Target Start/End: Complemental strand, 41735565 - 41735345
Alignment:
Q |
94 |
ctttcatgatccatgtaactcctcagtgagggttcgacaacaaaggcatatggtagaataatattttcgagctttctgttcttccaacagcttgcagtac |
193 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
41735565 |
ctttcatgatccatgtaacttctcagtgagggttcgacaacaaaggcatatggtagaataatattttcg-gctttctgttcttccaacagcttgcagtac |
41735467 |
T |
 |
Q |
194 |
tcgttggtttgcaacttgatatattaaacttcagtcatatatcaaaggtatagtaattacccatgataaattatttgttttttgacatacatcttcaaag |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41735466 |
tcgttggtttgcaacttgatatattaaacttcattcatatatcaaaggtatagtaattacccatgataaattatttgttttttgacatacatcttcaaag |
41735367 |
T |
 |
Q |
294 |
tgtacttggaaatcatcgaatc |
315 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
41735366 |
tgtacttggaaatcatcgaatc |
41735345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University