View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_25 (Length: 298)
Name: NF0255_low_25
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 34 - 225
Target Start/End: Complemental strand, 47698836 - 47698645
Alignment:
| Q |
34 |
aattagatagaaatagaaatatcatccttattcttctattgaacaacaaaaataaacaaattattaaaattaagtactcacacgactcaagaggtcatcg |
133 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| |||| ||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
47698836 |
aattagatagaaatagaaatataatccttattcttcttttgaacaacaaaaagaaacgaattattaaaaataagtactcacacgactcaagaagtcatcg |
47698737 |
T |
|
| Q |
134 |
gcgttatctgataaaagagaacgagcattttgttttgaactaattatctccaaaactatgactccaaaactgaaaacgtctgatttttctga |
225 |
Q |
| |
|
| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47698736 |
gagttatctgataaaagagaacgagaatttctttttgaactaattatctccaaaactatgactccaaaactgaaaacgtccgatttttctga |
47698645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 677 times since January 2019
Visitors: 2568