View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_27 (Length: 293)
Name: NF0255_low_27
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_27 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 58 - 293
Target Start/End: Complemental strand, 10565875 - 10565639
Alignment:
| Q |
58 |
ctactaaaagaagtggtccaataaggataattgtggtcctctcactcttgttacactttccctattgggcaaactgttggtttggtggcaattttatt-t |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10565875 |
ctactaaaagaagtggtccaataaggataattgtggtcctctcactcttgttacactttccctattgggcaaactgttggtttggtggcaattttattgt |
10565776 |
T |
 |
| Q |
157 |
ctaattaatcttctttcattgtcatatatgtagccattgatgttgatcgaaagacaaaaaagggagagttaagtttgtacaatatctacccataagggca |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10565775 |
ctaattaatcttctttcattgtcatatatgtagccattgatgttgatcgaaagacaaaaaagggagagttaagtttgtacaatatctacccataagggca |
10565676 |
T |
 |
| Q |
257 |
caaaacccttctatgaataatagtactgttttgcatt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10565675 |
caaaacccttctatgaataatagtactgttttgcatt |
10565639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University