View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_30 (Length: 286)
Name: NF0255_low_30
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 44 - 241
Target Start/End: Original strand, 4708164 - 4708361
Alignment:
| Q |
44 |
tcaaaagtatgtttcagccagtaacctgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccac |
143 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4708164 |
tcaaaagtatgattcagccagtaacttgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccac |
4708263 |
T |
 |
| Q |
144 |
tttaggatcaattagggcgtcaacgactatctgcaaaattatcatggattcttctttnnnnnnnntggtcatggattctataccattaaggttttcat |
241 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4708264 |
tttaggatcaagtagggtgtcaacgactatctgcaaaatgatcatggattcttctttaaaaaaaatgatcatggattctataccattaaggttttcat |
4708361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 65 - 180
Target Start/End: Original strand, 4745869 - 4745984
Alignment:
| Q |
65 |
taacctgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccactttaggatcaattagggcgtc |
164 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| |||||| |||||||||||| |||||| ||||| ||||||||||||||| ||||| ||| |
|
|
| T |
4745869 |
taacatgcgactttatgtatctctctattaggtcagcaagagctctaatcagtgactttggatcatatattatacccactttaggatcaagtagggagtc |
4745968 |
T |
 |
| Q |
165 |
aacgactatctgcaaa |
180 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
4745969 |
aacaactatctgcaaa |
4745984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University