View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_35 (Length: 276)
Name: NF0255_low_35
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 30 - 266
Target Start/End: Original strand, 36349223 - 36349459
Alignment:
| Q |
30 |
gtttggtttttactttttaactcaaaagtctacaaataccaaatttacacacaagatgtccattatatttaattagcatttatgcattatctctaaattg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36349223 |
gtttggtttttactttttaactcaaaagtctacaaataccaaatttacacacaagatgtccattatatttaattagcatttatgcattatctctaaattg |
36349322 |
T |
|
| Q |
130 |
aaatatgctagtctacacaaaaggaaaagagcttcatatgcactatatattttgaaataccactagtgctaagttttgcaacttagctcaatgtcctttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36349323 |
aaatatgctagtctacacaaaaggaaaagagcttcatatgcactatatattttgaaataccactagtgctaagttttgcaacttagctcaatgtcctttt |
36349422 |
T |
|
| Q |
230 |
caccccattaataatccttttcagacccctctctctg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36349423 |
caccccattaataatccttttcagacccctccctctg |
36349459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1241 times since January 2019
Visitors: 2574