View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_36 (Length: 274)
Name: NF0255_low_36
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 62 - 237
Target Start/End: Complemental strand, 28618232 - 28618059
Alignment:
| Q |
62 |
gaagataagatatctctgagcagcaaaaccaatctgacatacaccgcataagatacaataggcagtacagcaatgtgagcacataacataaataccagaa |
161 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||||||||| ||||||||| ||||||||| |||||||||||| |||| |||| ||| ||||||| |
|
|
| T |
28618232 |
gaagataagatatctctgagcaggaaaactattctgacatacacaacataagataaaataggcagcacagcaatgtgaccacaaaacagaaacaccagaa |
28618133 |
T |
 |
| Q |
162 |
ggaaattcttccaagaatattttttattggttaaatattaaaacatcatgtgaaacatgggtgagattccaacttc |
237 |
Q |
| |
|
|| || |||| ||||| | |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28618132 |
gggaagtctt-caagact-ttttttattgcttaaatattaaaacatcatgtgaaatatgggtgagattccaacttc |
28618059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 181 - 239
Target Start/End: Complemental strand, 28615958 - 28615900
Alignment:
| Q |
181 |
ttttttattggttaaatattaaaacatcatgtgaaacatgggtgagattccaacttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28615958 |
ttttttattggttaaatattaaaacatcatgtgaaacatgggtgagattccaacatcat |
28615900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 28616326 - 28616283
Alignment:
| Q |
62 |
gaagataagatatctctgagcagcaaaaccaatctgacatacac |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
28616326 |
gaagataagatatctctgtgcagcaaaatcaatctgatatacac |
28616283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University