View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_38 (Length: 265)
Name: NF0255_low_38
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 29 - 217
Target Start/End: Complemental strand, 38286913 - 38286725
Alignment:
| Q |
29 |
gaaaagaaaccgagaggcagtactaattaacaaccgaatgttgccaatctggatcccacggaaaaaatagatcaaatagattttctgtctcactttgtga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38286913 |
gaaaagaaaccgagaggcagtactaattaacaaccgaatgttgccaatctggatcccacggaaaaaatagatcaaatagattttctgtttcactttgtga |
38286814 |
T |
|
| Q |
129 |
aagatttgaaaaggaagaaatcattatgtattcaaaaatttaaatttcaggccttttgtaacaacaatgttaacatagttcatgtcagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38286813 |
aagatttgaaaaggaagaaatcattatgtattcaaaaatttaaatttcaggccttttgtaacaacaatgttaacatagttcatgtcagt |
38286725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University