View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_39 (Length: 265)
Name: NF0255_low_39
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 26 - 220
Target Start/End: Original strand, 12144689 - 12144883
Alignment:
| Q |
26 |
atgaacgctttaaagccagaagctcttcagaatttctagtgcaaacaatctcaataatcactttgtaatctggtgttgccttctttaatgcctcattaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12144689 |
atgaacgctttaaagccagaagctcttcagaatttctagtgcaaacaatctcaataatcactttgtaatctggtgttgccttctttaatgcctcgttaat |
12144788 |
T |
|
| Q |
126 |
aagtgtagcatctctttcagctggatccattatccaatgggaaatggctctctaatttcaatggtataaatttttggcaattagaatgatattca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12144789 |
aagtgtagcatctctttcagctggatccattatccaatgggaaatggctctctaatttcaatggtataaatttttggcaattagaatgatattca |
12144883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 680 times since January 2019
Visitors: 2568