View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_46 (Length: 217)
Name: NF0255_low_46
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0255_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 21 - 99
Target Start/End: Original strand, 5223643 - 5223721
Alignment:
| Q |
21 |
attttcaattttctgatggtggttccactagacaccgatgcaatgaagtgtttggattgacgttcaatgatattttctt |
99 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5223643 |
attttcaactttttgatggtggttcaactagacaccgatgcaatgaagtgtttggattgacgttcaatgatatattctt |
5223721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1236 times since January 2019
Visitors: 2574