View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0255_low_52 (Length: 202)
Name: NF0255_low_52
Description: NF0255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0255_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 40001586 - 40001707
Alignment:
Q |
1 |
acatttatattttctgcgactttttgtttttcttattactctgaaaatcataggcagaagaccctccataatatgtatcacaattcacaaccttaattcc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40001586 |
acatttatattttctgcgactttttgtttttcttattactctgaaaatcataggcagaagaccctccataatatgtatcacaattcacaaccttaattcc |
40001685 |
T |
 |
Q |
101 |
ttcctttttgttcttgaagaat |
122 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
40001686 |
ttcctttttgttcttgaagaat |
40001707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1191 times since January 2019
Visitors: 2573