View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0256-INSERTION-2 (Length: 109)
Name: NF0256-INSERTION-2
Description: NF0256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0256-INSERTION-2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 7e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 3678529 - 3678601
Alignment:
| Q |
37 |
ctgttatttgcgttagtggacacactctgaacattactcatgtaacttttcaagtaaaagtcatatgcggagg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678529 |
ctgttatttgcgttagtggacacactctgaacattactcatgtaacttttcaagtaaaagtcatatgcggagg |
3678601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University