View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0256-INSERTION-4 (Length: 434)
Name: NF0256-INSERTION-4
Description: NF0256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0256-INSERTION-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 8 - 334
Target Start/End: Original strand, 2759361 - 2759687
Alignment:
| Q |
8 |
ttcctttttatgttcttttatggaaattacctctgcatttttatgcactcnnnnnnncaaaaatgatgtcaatttctccacttcaatggtcccttcaact |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2759361 |
ttcccttttatgttcttttatggaaattacctctgcatttttatgcactctttttttcaaaaatgatgtcaatttctccacttcaatggtcccttcaact |
2759460 |
T |
 |
| Q |
108 |
attagactttgagctttcttgtcggttttaacattgaaaatccctgtatatatttggtcaaatttaatcacagcaaacttaattaacatggaatataaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2759461 |
attagactttgagctttcttgtcggttttaacattgaaaatccctgtatatatttggtcaaatttaatcacagcaaacttaattaacatggaatataaga |
2759560 |
T |
 |
| Q |
208 |
tttcaatattatataaatcatattactttgatttgagttacctttgtgcttgattaatctacgttttaggtcagcctcacatttgtcacaatgcatgtga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2759561 |
tttcaatattatataaatcatattactttgatttgagttacctttgtgcttgattaatctacgttttaggtcagcctcacatttgtcacaatgcatgtga |
2759660 |
T |
 |
| Q |
308 |
accttcaccgtgatagttcggacaatt |
334 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2759661 |
accttcaccgtgatagttcggacaatt |
2759687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University