View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0256_high_11 (Length: 311)
Name: NF0256_high_11
Description: NF0256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0256_high_11 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 90 - 291
Target Start/End: Original strand, 45414589 - 45414801
Alignment:
Q |
90 |
gattcgtaccgatgggcgtttgtgtttggcta---atcatcaatcatcatcannnnnnnnnnnnnnnnnnnaactgaatttccaattttcttcattcatc |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
45414589 |
gattcgtaccgatgggcgtttgtgtttggctaatcatcatcaatcatcatcatcctcctcctcctccctccgactgaatttccaattttcttcattcatc |
45414688 |
T |
|
Q |
187 |
cgtacacgtgtc--------tctttctttctttctttctgatcaattgatttgctatggagtcaccgattatcatcatctctctaaaaaccctaattccg |
278 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45414689 |
cgtacacgtgtctctttctttctttctttctttctttctgatcaattgatttgctatggagtcaccgattatcatcatctctctaaaaaccctaattccg |
45414788 |
T |
|
Q |
279 |
cactgattgatcc |
291 |
Q |
|
|
||||||||||||| |
|
|
T |
45414789 |
cactgattgatcc |
45414801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25934 times since January 2019
Visitors: 1215