View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0256_high_2 (Length: 538)
Name: NF0256_high_2
Description: NF0256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0256_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 75 - 490
Target Start/End: Complemental strand, 42703946 - 42703531
Alignment:
Q |
75 |
aaaacaaaggcagtggtaactgatacctgtgatgggtgtaagcaacaacataaccgcagttctaaacatcatagcaatattagcctcaataccaatcata |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703946 |
aaaacaaaggcagtggtaactgatacctgtgatgggtgtaagcaacaatataaccgcagttctaaacatcatagcaatattagcctcaataccaatcata |
42703847 |
T |
 |
Q |
175 |
gcttcaggaatttggctagcttcaaaaccagacaacgaatgcatagccaatttccgatggcccattgtcatagtcggcatccttgtcttcctcgttgctt |
274 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
42703846 |
gcttccggaatttggctagcttcaaaaccagacaacgaatgcatagccaatttccgatggcccattgtcataatcggcatccttgtcttcctcgttgctt |
42703747 |
T |
 |
Q |
275 |
taactggttttgtaggtgcttattataacaaagaaggtctcttagcactttacctttttgctatggcacttttaatcgctcttctactcatcatcctcgt |
374 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703746 |
taactggttttataggtgcttattataacaaagaaggtctcttagcactttacctttttgctatggcacttttaatcgctcttctactcatcatcctcgt |
42703647 |
T |
 |
Q |
375 |
tttcgccttcgttgttactagacctgatggaagctatgttgttcctgatagagggtacaaagagtttaggttagatgggttttcttcttggttgaggcac |
474 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703646 |
tttcgccttcgttgttactagacctgatggaagctatgttgttcctgatagagggtacaaagagtttaggttagatgggttttcttcttggttgaggcac |
42703547 |
T |
 |
Q |
475 |
cgtgtcacaggttctg |
490 |
Q |
|
|
||||| || ||||||| |
|
|
T |
42703546 |
cgtgttactggttctg |
42703531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 911 times since January 2019
Visitors: 2569