View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0256_high_4 (Length: 397)
Name: NF0256_high_4
Description: NF0256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0256_high_4 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 75 - 384
Target Start/End: Complemental strand, 42703946 - 42703637
Alignment:
Q |
75 |
aaaacaaaggcagtggtaactgatacctgtgatgggtgtaagcaacaacataaccgcagttctaaacatcatagcaatattagcctcaataccaatcata |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703946 |
aaaacaaaggcagtggtaactgatacctgtgatgggtgtaagcaacaatataaccgcagttctaaacatcatagcaatattagcctcaataccaatcata |
42703847 |
T |
|
Q |
175 |
gcttcaggaatttggctagcttcaaaaccagacaacgaatgcatagccaatttccgatggcccattgtcatagtcggcatccttgtcttcctcgttgctt |
274 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
42703846 |
gcttccggaatttggctagcttcaaaaccagacaacgaatgcatagccaatttccgatggcccattgtcataatcggcatccttgtcttcctcgttgctt |
42703747 |
T |
|
Q |
275 |
taactggttttgtaggtgcttattataacaaagaaggtctcttagcactttacctttttgctatggcacttttaatcgctcttctactcatcatcctcgt |
374 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42703746 |
taactggttttataggtgcttattataacaaagaaggtctcttagcactttacctttttgctatggcacttttaatcgctcttctactcatcatcctcgt |
42703647 |
T |
|
Q |
375 |
tttccccttc |
384 |
Q |
|
|
|||| ||||| |
|
|
T |
42703646 |
tttcgccttc |
42703637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5591 times since January 2019
Visitors: 8770