View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0256_high_5 (Length: 376)
Name: NF0256_high_5
Description: NF0256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0256_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 75 - 359
Target Start/End: Complemental strand, 42703946 - 42703662
Alignment:
| Q |
75 |
aaaacaaaggcagtggtaactgatacctgtgatgggtgtaagcaacaacataaccgcagttctaaacatcatagcaatattagcctcaataccaatcata |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42703946 |
aaaacaaaggcagtggtaactgatacctgtgatgggtgtaagcaacaatataaccgcagttctaaacatcatagcaatattagcctcaataccaatcata |
42703847 |
T |
 |
| Q |
175 |
gcttcaggaatttggctagcttcaaaaccagacaacgaatgcatagccaatttccgatggcccattgtcatagtcggcatccttgtcttcctcgttgctt |
274 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42703846 |
gcttccggaatttggctagcttcaaaaccagacaacgaatgcatagccaatttccgatggcccattgtcataatcggcatccttgtcttcctcgttgctt |
42703747 |
T |
 |
| Q |
275 |
taactggttttgtaggtgcttattataacaaagaaggtctcttagcactttacctttttgctatggcacttttaatcgctcttct |
359 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42703746 |
taactggttttataggtgcttattataacaaagaaggtctcttagcactttacctttttgctatggcacttttaatcgctcttct |
42703662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University