View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0257_high_10 (Length: 257)

Name: NF0257_high_10
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0257_high_10
NF0257_high_10
[»] chr7 (1 HSPs)
chr7 (12-178)||(26881084-26881250)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 178
Target Start/End: Original strand, 26881084 - 26881250
Alignment:
12 cagagaggaatgtggactcaccaaaatgaagttgttcccaaggccatgatgcttagagaaatggtgaaagccggtctccttttggtggaggaggttgttt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
26881084 cagagaggaatgtggactcaccaaaatgaagttgttcccaaggccatgatacttagagaaatggtgaaagccggtctccttttggtcgaggaggttgttt 26881183  T
112 taataggagtttatgttccaatcgaggaagcaaccaggcgggaattagggaacaagagaagaacaca 178  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||    
26881184 taataggagtttatgttctaatcgaggaagcaacgaggcgggaattacggaacaagagaagaacaca 26881250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University