View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0257_high_7 (Length: 311)
Name: NF0257_high_7
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0257_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 83 - 237
Target Start/End: Original strand, 8045258 - 8045410
Alignment:
| Q |
83 |
aatgtcaccgaagtgcgaccccatttggtatcannnnnnn-ctgcaaacaacaacattaccaaattttactcatatgactaaaaccaaatgtttaccgaa |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| | |||| | || | |
|
|
| T |
8045258 |
aatgtcaccgaagtgctaccccatttggtatcattttttttctgcaaacaacaacattaccaaatgttactcatatgactaaagaccaatgat-ac--at |
8045354 |
T |
 |
| Q |
182 |
gtgcactttgatgttgtgattggttacattatttatgaataaattggattgtacct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8045355 |
gtgcactttgatgttgtgattggttacattatttatgaatatattggattgtacct |
8045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 233 - 283
Target Start/End: Original strand, 8046098 - 8046148
Alignment:
| Q |
233 |
tacctaattatgcataattagatcaaatgcatatgtttttctaatttatgt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046098 |
tacctaattatgcataattagatcaaatgcatatgtttttctaatttatgt |
8046148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University