View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0257_low_10 (Length: 311)

Name: NF0257_low_10
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0257_low_10
NF0257_low_10
[»] chr6 (2 HSPs)
chr6 (83-237)||(8045258-8045410)
chr6 (233-283)||(8046098-8046148)


Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 83 - 237
Target Start/End: Original strand, 8045258 - 8045410
Alignment:
83 aatgtcaccgaagtgcgaccccatttggtatcannnnnnn-ctgcaaacaacaacattaccaaattttactcatatgactaaaaccaaatgtttaccgaa 181  Q
    |||||||||||||||| ||||||||||||||||        |||||||||||||||||||||||| |||||||||||||||||  | |||| | ||  |     
8045258 aatgtcaccgaagtgctaccccatttggtatcattttttttctgcaaacaacaacattaccaaatgttactcatatgactaaagaccaatgat-ac--at 8045354  T
182 gtgcactttgatgttgtgattggttacattatttatgaataaattggattgtacct 237  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
8045355 gtgcactttgatgttgtgattggttacattatttatgaatatattggattgtacct 8045410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 233 - 283
Target Start/End: Original strand, 8046098 - 8046148
Alignment:
233 tacctaattatgcataattagatcaaatgcatatgtttttctaatttatgt 283  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
8046098 tacctaattatgcataattagatcaaatgcatatgtttttctaatttatgt 8046148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University