View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0257_low_12 (Length: 267)
Name: NF0257_low_12
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0257_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 31694272 - 31694524
Alignment:
| Q |
1 |
ttctctctacagtttcatcccatctcccattccgcctccgtccaatccaccggcggcagcctcttagccgcctaccacctccaagtccg-cctctgcacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31694272 |
ttctctctacagtttcatcccatctcccatttcgcctccgtccaatccaccggcggcagcctcttagccgcctaccacctccaagtccgccctctgcacc |
31694371 |
T |
|
| Q |
100 |
gtctctctcccagtctcgcacaataacaggtatcctctannnnnnnnnnnnnnnnnncattttctgttttgaatctcaattattagggttactcaatttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31694372 |
gtctctctcccagtctcgcacaataacaggtatcctctatctctctctctctctctccattttcttttttgaatctcaattattagggttactcaatttg |
31694471 |
T |
|
| Q |
200 |
ggattttttgcgtttgactctaattatgttaaattgatgattgattgtataat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31694472 |
ggattttttgcgtttgactctaattatgtttaattgatgattgattgtataat |
31694524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University