View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0257_low_13 (Length: 257)
Name: NF0257_low_13
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0257_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 178
Target Start/End: Original strand, 26881084 - 26881250
Alignment:
| Q |
12 |
cagagaggaatgtggactcaccaaaatgaagttgttcccaaggccatgatgcttagagaaatggtgaaagccggtctccttttggtggaggaggttgttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26881084 |
cagagaggaatgtggactcaccaaaatgaagttgttcccaaggccatgatacttagagaaatggtgaaagccggtctccttttggtcgaggaggttgttt |
26881183 |
T |
|
| Q |
112 |
taataggagtttatgttccaatcgaggaagcaaccaggcgggaattagggaacaagagaagaacaca |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
26881184 |
taataggagtttatgttctaatcgaggaagcaacgaggcgggaattacggaacaagagaagaacaca |
26881250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University