View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0257_low_16 (Length: 246)
Name: NF0257_low_16
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0257_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 26880969 - 26880754
Alignment:
| Q |
1 |
ctctgtgatcgtaacttcagtgttggtgctgatggagttatatttgtcttgcctggtatcaatggcactgactatacgatgaggattttcaaccctgatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
26880969 |
ctctgtgatcgtaacttcagtgttggtgcagatgaagttatatttgtcttgcctggtatcaatggcactgactatacaatgaggattttcaactctgatg |
26880870 |
T |
|
| Q |
101 |
gtagtgagccttaggtgattaattgttcttaaaattatatttgttcaggtacgtgtcgtaattggttcttggtcttcattaactgacaagtttgctttgt |
200 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| ||| ||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880869 |
gtagtgagcctgaggtgattaattcttcttaaaattgtatgtgttcaggtacgtatcgtgatttgttcttggtcttcattaactgacaagtttgctttgt |
26880770 |
T |
|
| Q |
201 |
ttcttacattcatgca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26880769 |
ttcttacattcatgca |
26880754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 40252576 - 40252464
Alignment:
| Q |
4 |
tgtgatcgtaacttcagtgttggtgctgatggagttatatttgtcttgcctggtatcaatggcactgactatacgatgaggattttcaaccctgatggta |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||| |||||||||||| |||| ||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
40252576 |
tgtgatcgtaactttggtgttggtgctgatggagttatctttgtattgcctggtatcgatggtactgattatacaatgaggattttcaactctgatggta |
40252477 |
T |
|
| Q |
104 |
gtgagccttaggt |
116 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
40252476 |
gtgagcctgaggt |
40252464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University