View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0257_low_19 (Length: 210)
Name: NF0257_low_19
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0257_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 44 - 132
Target Start/End: Original strand, 40411527 - 40411612
Alignment:
| Q |
44 |
ataattgcttgccgaatactactgctagtacaaagtgtacaaccttgttacatgatatatataagctgaatacgtacgttgtccttcat |
132 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40411527 |
ataattgcttgccgaatactact---agtacaaagtgtacaaccttgttacatgatatatataaactgaatacgtacgttgtccttcat |
40411612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University