View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0257_low_20 (Length: 205)
Name: NF0257_low_20
Description: NF0257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0257_low_20 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 95 - 205
Target Start/End: Original strand, 38160802 - 38160912
Alignment:
| Q |
95 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgtgcacttgatgccccaaatgaggaagc |
194 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
38160802 |
cttttaactttccaatatgcaggattcacaaggagcaggtcgaaaaatggcaggaagaaatcaaagaactgcgtgcacttgatgcctcaaatgaggaagc |
38160901 |
T |
 |
| Q |
195 |
caatgctcttc |
205 |
Q |
| |
|
||||||||||| |
|
|
| T |
38160902 |
caatgctcttc |
38160912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 95 - 205
Target Start/End: Original strand, 38116976 - 38117086
Alignment:
| Q |
95 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgtgcacttgatgccccaaatgaggaagc |
194 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | |||||||| |||||| ||||||||||||| |
|
|
| T |
38116976 |
cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgtgcactcgatgcctcaaatgaggaagc |
38117075 |
T |
 |
| Q |
195 |
caatgctcttc |
205 |
Q |
| |
|
||||||||||| |
|
|
| T |
38117076 |
caatgctcttc |
38117086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 95 - 205
Target Start/End: Original strand, 49004779 - 49004889
Alignment:
| Q |
95 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgtgcacttgatgccccaaatgaggaagc |
194 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | || ||||| |||||| ||||||||||||| |
|
|
| T |
49004779 |
cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgagcactcgatgcctcaaatgaggaagc |
49004878 |
T |
 |
| Q |
195 |
caatgctcttc |
205 |
Q |
| |
|
||||||||||| |
|
|
| T |
49004879 |
caatgctcttc |
49004889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University