View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0258_high_12 (Length: 251)
Name: NF0258_high_12
Description: NF0258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0258_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 53 - 222
Target Start/End: Complemental strand, 10511004 - 10510835
Alignment:
Q |
53 |
ccctctttcatatcatcccttgaaagccgtcctattccctcttctaccttcaaagaccattaattaagcacaatatttactgataactgctcccaaaaag |
152 |
Q |
|
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
10511004 |
ccctctttcatatcatctcttgaaagccctcctattccctcttctaccttcaaagaccattaattaagcacaatatttactgataacggctcccaaaaag |
10510905 |
T |
 |
Q |
153 |
aaccttacaataccatttatacctgcagatgttagagctctcatacgaggccatccatgtgacgagcaaa |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10510904 |
aaccttacaataccatttatacctgcagatgttagagctctcatacgaggccatccatgtgacgagcaaa |
10510835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University