View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0258_high_2 (Length: 452)
Name: NF0258_high_2
Description: NF0258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0258_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 30 - 448
Target Start/End: Original strand, 35218126 - 35218546
Alignment:
| Q |
30 |
gaacccacagaaacgagcaattcctgaaacaaataaagaagagttgaatgagtgtgagatgcaagagtaatagatataatcggtgtaagtaagtaagtaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35218126 |
gaacccacagaaacgagcaattcctgaaacaaataaagaagagttgaatgagtgtgagatgcaagagtaatagatataatcggtgtaa----gtaagtaa |
35218221 |
T |
|
| Q |
130 |
gttagttagttaaccttaattctaggaatagcccaatggttaagagatttctcttcccaagtaccagcacgattccaagcagaacccaattgatgagatt |
229 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35218222 |
gtaagttagttaaccttaattctaggaatagcccaatggttaagagatttctcttcccaagtaccagcacgattccaagcagaacccaattgatgagatt |
35218321 |
T |
|
| Q |
230 |
gagattcagattcag------------gctgtagcttttgtggaacaggtaagggggctgcagcttcagttttattacgaacccaataagtatacgacga |
317 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35218322 |
gagattgagattcagaagaagattgttgctgtagcttttgtggaacaggtaagggggctgcagcttcagttttattacgaacccaataagtatacgacga |
35218421 |
T |
|
| Q |
318 |
cgctgctttttcttcttcttcttgagatttcgaattcgacgatgacgtcactacttctccaactcctcctccgctaagggactccattgatttcattctt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35218422 |
cgctgctttttcttcttcttcttgagatttcgaattcgacgatgacgtcactactt------ctcctcctccgctaagggactccattgatttctttctt |
35218515 |
T |
|
| Q |
418 |
caacagacgccgctcgtacttcatctcactc |
448 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |
|
|
| T |
35218516 |
caacagacgccgctcgtacttcaactcactc |
35218546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 876 times since January 2019
Visitors: 2569