View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0258_low_11 (Length: 280)
Name: NF0258_low_11
Description: NF0258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0258_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 3 - 251
Target Start/End: Complemental strand, 4242325 - 4242077
Alignment:
| Q |
3 |
agaagaaacaaaggacacaaaagagtgttccagagtttacaaaaaacagtgagaattgtgcaattttcagaaacagcaatggaaggaagaaagaagagag |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4242325 |
agaacaaacaaaggacacaaaagagtgttccagagtttacaaaaaacagtgaaaattgttcaattttcagaaacagtaatggaaggaagaaagaagagag |
4242226 |
T |
 |
| Q |
103 |
cgtttgcttcaacaatttcaccaacaatggtgtttctgttacttggttttgctgttcttgtcatgttacccatggtctcagctacaaggtttatggttgg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4242225 |
tgtttgcttcaacaatttcaccaacaatggtgtttctgttacttggttttgctgttcttgtcatgttacccatggtctcagctacgaggtttatggttgg |
4242126 |
T |
 |
| Q |
203 |
tggtagaatgggttggaacacaaatttcaactacactacttgggctaag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4242125 |
tggtagaatgggttggaacacaaatttcaactacactacttgggctaag |
4242077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University