View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0258_low_9 (Length: 367)
Name: NF0258_low_9
Description: NF0258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0258_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 27312509 - 27312764
Alignment:
| Q |
1 |
ttcaaatgatgaagaagtagaacatattgttgaagaggaacaaaagaaagccaacgtggaagtggaaaattcacctaaggtagatgtacttcataggtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27312509 |
ttcaaatgatgaagaagtagaacatattgttgaagaggaacaaaagaaagccaacgtggaagtggaaaattcacctaaggtagatgtacttcgtaggtct |
27312608 |
T |
 |
| Q |
101 |
aaaacatattctgcaccaacacggtcaagatcaacaggattcttatctattctcttgttatcacggtcaaactcaacaggtgtgttggtgcaaccaggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312609 |
aaaacatattctgcaccaacacggtcaagatcaacaggattcttatctattctcttgttatcacggtcaaactcaacaggtgtgttggtgcaaccaggtg |
27312708 |
T |
 |
| Q |
201 |
aggattgtgagaggtttacattgagattacccgataaagttcgaaagcagatgatg |
256 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
27312709 |
aggattgtgagaggtttacactgaggttacccgataaagttcgaaagcagatgatg |
27312764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 277 - 338
Target Start/End: Complemental strand, 27312230 - 27312169
Alignment:
| Q |
277 |
acgaaaagttgggaatgtgtctataacttcttggttaagaccattacttggctcgttatttt |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
27312230 |
acgaaaagttgggaatgtgtctataacttcttggttaagaccgttacttggctcgttgtttt |
27312169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University