View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_11 (Length: 322)
Name: NF0259_low_11
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0259_low_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 88 - 322
Target Start/End: Original strand, 29281269 - 29281503
Alignment:
| Q |
88 |
cttcggttatgaatttaaggaaatgggcctggagacgggcttgggcctgaggacggagtttgggccaaagatgagagggtttgacaaaaacaagagcgcg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281269 |
cttcggttatgaatttaaggaaatgggcctggagacgggcttgggcctgaggacggagtttaggccaaagatgagagggtttgacaaaaacaagagcgcg |
29281368 |
T |
 |
| Q |
188 |
tgcagcgtttgtgcgagtggggatttctggggatgaggttagaaggaaaaagagtttgatcatgaggagatcagggtggtggtgtttgcaacattgaagg |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281369 |
tgcagcgtttgtgcgagtagggatttctggggatgaggttagaaggaaaaagagtttgatcatgaggagatcagggtggtggtgtttgcaacattgaagg |
29281468 |
T |
 |
| Q |
288 |
aatgtgagtgattttgatcggttttgttgttgttc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281469 |
aatgtgagtgattttgatcggttttgttgttgttc |
29281503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University