View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_12 (Length: 305)
Name: NF0259_low_12
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0259_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 102 - 240
Target Start/End: Complemental strand, 36014155 - 36014017
Alignment:
| Q |
102 |
cataaccaagcataagttggtttcctatttaccaaaaaacaactatacttgttgaagtattcaaacagaaatgcctagaatacgtttcaagttaagctta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36014155 |
cataaccaagcataagttggtttcctatttaccaaaaaacaactatacttgttgaagtattcaaacagaaatgccttgaatacgtttcaagttaagctta |
36014056 |
T |
|
| Q |
202 |
aagttacaatggtagtactagtactgtttaagtattatc |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36014055 |
aagttacaatggtagtaccagtactgtttaagtattatc |
36014017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University