View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_15 (Length: 294)
Name: NF0259_low_15
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0259_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 81 - 198
Target Start/End: Original strand, 13908078 - 13908195
Alignment:
Q |
81 |
gaagaaaattctatggtgcagaaatttgtggtaagttaatgtgttttaagtttctaaagtcaaatgttttttaactgtatgttccttgatgtaatttgtg |
180 |
Q |
|
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
13908078 |
gaagaaaattctagggtgtagaaatttgtggtaagttaatgtgttttaagtttctaaagtcaaatgttttttgactgtatgttccttgatgtaatttgtg |
13908177 |
T |
 |
Q |
181 |
tgaatctgcagtgcccta |
198 |
Q |
|
|
||||| || ||||||||| |
|
|
T |
13908178 |
tgaatatgtagtgcccta |
13908195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University