View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_17 (Length: 245)
Name: NF0259_low_17
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0259_low_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 55 - 245
Target Start/End: Original strand, 31867837 - 31868029
Alignment:
| Q |
55 |
ttctccatatctgtggaattcattcatattgtcaaattgatacacagggatctgatattccaatgtaaagttaca--tatatatgatatgcccacatgat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31867837 |
ttctccatatctgtggaattcattcatattgtcaaattgatacacagggatctgatattccaatgtaaagttacacatatatatgatatgcccacatgat |
31867936 |
T |
|
| Q |
153 |
agcatcacattcaaactcaatatctaatttcatgctttgtcttgtcgtattggttttacctgtgatgaacaatctcggttgtcacggtgtttg |
245 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31867937 |
aacatcacattcaaactcaatatctaatttcatgctttgtcttgtcctattggttttacctgtgatgaacaatctcggttgtcaccgtgtttg |
31868029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University