View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_32 (Length: 205)
Name: NF0259_low_32
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0259_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 44027062 - 44026953
Alignment:
| Q |
1 |
attcaattaagtgaagttgaatgttgacagagttgtttaagaacgcattaaattgtcaaagctgaagatagggaa---caccctcgttaactaaaccatc |
97 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
44027062 |
attcaattaagtgaagttgaatgctgacagagttgtttaagaaagcattaaattgtcaaagctgaagatagggaactgcaccctcattaactaaaccatc |
44026963 |
T |
 |
| Q |
98 |
tacattagat |
107 |
Q |
| |
|
|||||||||| |
|
|
| T |
44026962 |
tacattagat |
44026953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 43293899 - 43294008
Alignment:
| Q |
1 |
attcaattaagtgaagttgaatgttgacagagttgtttaagaacgcattaaattgtcaaagctgaagatagggaa---caccctcgttaactaaaccatc |
97 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
43293899 |
attcaattaagtgaagttgaatgctgacagagttgtttaagaaagcattaaattgtcaaagctgaagatagggaactgcaccctcattaactaaaccatc |
43293998 |
T |
 |
| Q |
98 |
tacattagat |
107 |
Q |
| |
|
|||||||||| |
|
|
| T |
43293999 |
tacattagat |
43294008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University