View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0259_low_33 (Length: 203)

Name: NF0259_low_33
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0259_low_33
NF0259_low_33
[»] chr5 (1 HSPs)
chr5 (1-146)||(42950952-42951096)
[»] chr8 (2 HSPs)
chr8 (1-132)||(2852569-2852699)
chr8 (1-132)||(2904601-2904731)
[»] chr1 (1 HSPs)
chr1 (27-93)||(1179628-1179694)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 42950952 - 42951096
Alignment:
1 ctggttttgtgtacctctgtaatgttgtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg 100  Q
    |||||||||||||||| |||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42950952 ctggttttgtgtacctatgtaatgtagtggtgtaaatgtttg-tcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg 42951050  T
101 agcgttggatttggcggctgtttttggtaacacagttagaattatc 146  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||    
42951051 agcgttggatttggcggctgtttttggtaacacagttggaattatc 42951096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 2852569 - 2852699
Alignment:
1 ctggttttgtgtacctctgtaatgttgtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg 100  Q
    |||||||||| ||  |||||||||| |||||||| ||||||||| | |||||||||||||||| ||   || | |   || | ||||||| |||||||||    
2852569 ctggttttgtatatttctgtaatgtagtggtgaagatgtttgattacggctggatccttgtggagctgggacagtct-atattagattaattttcagtgg 2852667  T
101 agcgttggatttggcggctgtttttggtaaca 132  Q
     |||||||||||||||||||||||||||||||    
2852668 ggcgttggatttggcggctgtttttggtaaca 2852699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 2904601 - 2904731
Alignment:
1 ctggttttgtgtacctctgtaatgttgtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg 100  Q
    |||||||||| || |||||||| || |||||||| ||||||||| | |||||||||||||||| ||   || | |   || | ||||||| |||||||||    
2904601 ctggttttgtatatctctgtaacgtagtggtgaagatgtttgattacggctggatccttgtggagctgggacagtct-atattagattaactttcagtgg 2904699  T
101 agcgttggatttggcggctgtttttggtaaca 132  Q
     |||||||||||||||||||||||||||||||    
2904700 ggcgttggatttggcggctgtttttggtaaca 2904731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 27 - 93
Target Start/End: Original strand, 1179628 - 1179694
Alignment:
27 gtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatt 93  Q
    |||||||| |||| || |||  ||||||||||||||||||   ||||||||||||||||||||||||    
1179628 gtggtgaagatgtatggtcactgctggatccttgtggtgctgggatatttgcatttcagattaaatt 1179694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 444 times since January 2019
Visitors: 2566