View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_33 (Length: 203)
Name: NF0259_low_33
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0259_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 42950952 - 42951096
Alignment:
Q |
1 |
ctggttttgtgtacctctgtaatgttgtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg |
100 |
Q |
|
|
|||||||||||||||| |||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42950952 |
ctggttttgtgtacctatgtaatgtagtggtgtaaatgtttg-tcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg |
42951050 |
T |
 |
Q |
101 |
agcgttggatttggcggctgtttttggtaacacagttagaattatc |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
42951051 |
agcgttggatttggcggctgtttttggtaacacagttggaattatc |
42951096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 2852569 - 2852699
Alignment:
Q |
1 |
ctggttttgtgtacctctgtaatgttgtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg |
100 |
Q |
|
|
|||||||||| || |||||||||| |||||||| ||||||||| | |||||||||||||||| || || | | || | ||||||| ||||||||| |
|
|
T |
2852569 |
ctggttttgtatatttctgtaatgtagtggtgaagatgtttgattacggctggatccttgtggagctgggacagtct-atattagattaattttcagtgg |
2852667 |
T |
 |
Q |
101 |
agcgttggatttggcggctgtttttggtaaca |
132 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2852668 |
ggcgttggatttggcggctgtttttggtaaca |
2852699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 2904601 - 2904731
Alignment:
Q |
1 |
ctggttttgtgtacctctgtaatgttgtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatttcagtgg |
100 |
Q |
|
|
|||||||||| || |||||||| || |||||||| ||||||||| | |||||||||||||||| || || | | || | ||||||| ||||||||| |
|
|
T |
2904601 |
ctggttttgtatatctctgtaacgtagtggtgaagatgtttgattacggctggatccttgtggagctgggacagtct-atattagattaactttcagtgg |
2904699 |
T |
 |
Q |
101 |
agcgttggatttggcggctgtttttggtaaca |
132 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2904700 |
ggcgttggatttggcggctgtttttggtaaca |
2904731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 27 - 93
Target Start/End: Original strand, 1179628 - 1179694
Alignment:
Q |
27 |
gtggtgaaaatgtttgatcatggctggatccttgtggtgccaagatatttgcatttcagattaaatt |
93 |
Q |
|
|
|||||||| |||| || ||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
1179628 |
gtggtgaagatgtatggtcactgctggatccttgtggtgctgggatatttgcatttcagattaaatt |
1179694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University