View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0259_low_9 (Length: 329)
Name: NF0259_low_9
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0259_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 87 - 238
Target Start/End: Complemental strand, 35771161 - 35771010
Alignment:
| Q |
87 |
ctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgagat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35771161 |
ctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgagat |
35771062 |
T |
 |
| Q |
187 |
cttgaagcttgttgagtgataaaatagaaggatggatttcacgcagattttt |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35771061 |
cttgaagcttgtcgagtgataaaatagaaggatggatttcacgcagattttt |
35771010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University