View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0259_low_9 (Length: 329)

Name: NF0259_low_9
Description: NF0259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0259_low_9
NF0259_low_9
[»] chr3 (1 HSPs)
chr3 (87-238)||(35771010-35771161)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 87 - 238
Target Start/End: Complemental strand, 35771161 - 35771010
Alignment:
87 ctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgagat 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35771161 ctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgagat 35771062  T
187 cttgaagcttgttgagtgataaaatagaaggatggatttcacgcagattttt 238  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||    
35771061 cttgaagcttgtcgagtgataaaatagaaggatggatttcacgcagattttt 35771010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University