View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_high_16 (Length: 309)
Name: NF0260_high_16
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 63 - 235
Target Start/End: Complemental strand, 25739115 - 25738943
Alignment:
| Q |
63 |
ccgtaattcatagattccaccaatgcaatcacataggtttttcaacactgccatccttcaaccaaatagccaagataatcttgaatcaccatgtgattct |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25739115 |
ccgtaattcatagattccaccaatgcaatcacataggtttttcaacactgccatccttcaaccaaatagccaagataatcttgaatcaccatgtgattct |
25739016 |
T |
|
| Q |
163 |
catttctttcaaaataacttccaaaaaagactcccagcacactcagaattctacaggattccatggtctgcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25739015 |
catttctttcaaaataacttccaaaaaagactcccagcacactcagaattctacaggattccatggtctgcat |
25738943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 681 times since January 2019
Visitors: 2568