View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_high_22 (Length: 267)
Name: NF0260_high_22
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0260_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 12544304 - 12544113
Alignment:
Q |
35 |
ggacatcatcatcgaataatcaaattctaatttcactgtagc---tgtcaaatatagtaatagttcataca-cccatgcacgtgaagttttgcaattgta |
130 |
Q |
|
|
||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||||||||||| |
|
|
T |
12544304 |
ggacatcatgattgaataatcaaattctaatttcactgtagcaactgtcaaatatagtaataggtcatagaacccatgcacgtgaagttttgcaattgta |
12544205 |
T |
 |
Q |
131 |
ggagcaacaatccaaaaattgttgaattcatggaacaacatattattctcatagtactttaaatactacacctccctctcactacaaaatac |
222 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
12544204 |
ggagcaacagtccaaaaattgttgaattcatggaacaacatattattctcagagtactttaaatactacacctccctctcacgacaaaatac |
12544113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University