View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_high_27 (Length: 248)
Name: NF0260_high_27
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0260_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 113 - 226
Target Start/End: Complemental strand, 32425705 - 32425592
Alignment:
Q |
113 |
gcagagacgtgtccagcttgatttggaggaacgtatccgccttaatttggagtagcgtaagcgttgaaggtgagcattgttcctaacccacacctcatga |
212 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32425705 |
gcagaggcgtgtccagcttgatttggaggaacgtatccgccttaatttggagtagcgtaagcgttgaaggtgagcattgttcctaacccacacctcatga |
32425606 |
T |
 |
Q |
213 |
tacttaggatcata |
226 |
Q |
|
|
|||||||||||||| |
|
|
T |
32425605 |
tacttaggatcata |
32425592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 32421347 - 32421305
Alignment:
Q |
184 |
gagcattgttcctaacccacacctcatgatacttaggatcata |
226 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
32421347 |
gagcattgttcctaacccactcctcatgatacttgggatcata |
32421305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 1543672 - 1543630
Alignment:
Q |
184 |
gagcattgttcctaacccacacctcatgatacttaggatcata |
226 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |||||||| |
|
|
T |
1543672 |
gagcattgttcctaacccactcctcatgatacttgggatcata |
1543630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 559 times since January 2019
Visitors: 2567