View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_high_30 (Length: 236)
Name: NF0260_high_30
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_high_30 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 104 - 236
Target Start/End: Complemental strand, 11024223 - 11024091
Alignment:
| Q |
104 |
taaccattggtactccggaacttattgcttccacggtcgcgttccagccacaatgcgttaagaatccgcctatcgatggatgatccaatattaacgcttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024223 |
taaccattggtactccggaacttattgcttccacggtcgcgttccagccacaatgcgttaagaatccgcctatcgatggatgatccaatattaacgcttg |
11024124 |
T |
 |
| Q |
204 |
tggaacccatcctttaatcaacattcctttctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11024123 |
tggaacccatcctttaatcaacattcctttctt |
11024091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University