View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_21 (Length: 306)
Name: NF0260_low_21
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 10 - 207
Target Start/End: Complemental strand, 17231894 - 17231697
Alignment:
| Q |
10 |
aagaaaatcagaaaggaggaacttttggatgaagttgaaatctgttttgaaaaagatagaggataaggtataaggttccttcatgttgatcacaatcgaa |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17231894 |
aagagaatcagaaaggaggaacttttggatgaagttgaaatctgttttgaaaaatatagaggataaggtataaggttccttcatgttgatcataatcgaa |
17231795 |
T |
 |
| Q |
110 |
tctatctagcattccaaaatcattactattttttatcttgcataatatgatgatcacaaaatatgctagagtctaaaagtcataactacagaacacag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17231794 |
tctatctagcattccaaaatcattactattttttatgttgcataatatgatgatcacaaaatatgctagagtctaaaagtcataactactgaacacag |
17231697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 201 - 278
Target Start/End: Complemental strand, 17230851 - 17230774
Alignment:
| Q |
201 |
aacacaggaattgccaaagatcgaaaagaagacaaagttagttcatgttaatagaggtagaagtatcagaacttaact |
278 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17230851 |
aacacaagaattgccaaagatcgaaaagaagacaaagttagttcatgttaatagaggtagaagtatcagaacttaact |
17230774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University