View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_22 (Length: 305)
Name: NF0260_low_22
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_low_22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 26 - 305
Target Start/End: Complemental strand, 11696329 - 11696050
Alignment:
| Q |
26 |
tcaatcatatcaacataaagcaacaaagcttcttctagtttcatgtcattaacatttcctctaatcattgtgttatagtcaaaactactcggtccatcga |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11696329 |
tcaatcatatcaacataaagcaacaaagcttcttctagtttcatgtcattaacatttcctctaatcattgtgttatagtcaaaactactcggttcatcga |
11696230 |
T |
|
| Q |
126 |
tctgagtgaagattgaacaagcataatccatgctaccccattttgttagagcacaagttgcaacaagattgctcatacaaaatgtatcaaagaaaatacc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696229 |
tctgagtgaagattgaacaagcataatccatgctaccccattttgttagagcacaagttgcaacaagattgctcatacaaaatgtatcaaagaaaatacc |
11696130 |
T |
|
| Q |
226 |
acatttcaaaacatgggcatgaacttgcttaaattcttccatactattgcatcttttgagtaaacataaccatctttttt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696129 |
acatttcaaaacatgggcatgaacttgcttaaattcttccatactattgcatcttttgagtaaacataaccatctttttt |
11696050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 499 times since January 2019
Visitors: 2566