View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_23 (Length: 289)
Name: NF0260_low_23
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0260_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 41614154 - 41613980
Alignment:
Q |
46 |
attatactaactaatgacatacccatttatttatgtttttctaattctatattcaaggactattatgacaatgttccacacattgaacaactgaaataac |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41614154 |
attatactaactaatgacatacccatttatttatgtttttctaattctatattcaaggactattatgacaatgttccacacattgaacaactgaaataac |
41614055 |
T |
 |
Q |
146 |
tatttactcaaattttaatgtaacttgtttgtagaccnnnnnnnnntacctgtagaacaacggtgcctgacagaac |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
41614054 |
tatttactcaaattttaatgtaacttgtttgtagacc-aaaaaaaatacctgtagaacaacggtgcctgacagaac |
41613980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 210 times since January 2019
Visitors: 2563