View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_25 (Length: 278)
Name: NF0260_low_25
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 44 - 219
Target Start/End: Complemental strand, 11293647 - 11293472
Alignment:
| Q |
44 |
gaaatgttgtttgtattgttgattcctatgctatacggttacaaatattttatactataaattaaattaaacccctatctcacactctgcaagactgcaa |
143 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11293647 |
gaaatgttgtttgtattgttaattcctatgctatacggtaacaaatattttatactataaattaaattaaacccccatctcacactctgcaagactgcaa |
11293548 |
T |
|
| Q |
144 |
catatatccttccatagataccttcagaatcaaaatgtctcaagaaatttgcatactgccattcttcggacaaggc |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11293547 |
catatatccttccattgataccttcagaatcaaaatgtctcaagaaatttgcatactgccattcttcggacaaggc |
11293472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 236 times since January 2019
Visitors: 2563