View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_26 (Length: 278)
Name: NF0260_low_26
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_low_26 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 85 - 278
Target Start/End: Complemental strand, 4600186 - 4599990
Alignment:
| Q |
85 |
aaatactgtgacaccttaaaaatgaatggtgttacaaatgatgttacaagacttggactttttctttttcactaaaggatagagttagaacttaac---a |
181 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
4600186 |
aaatacagtgacaccttaaaaatgaatggtgttacaaatgatgttacaagacttggactttttctttttcactaaaggatagagttagaacttgactaca |
4600087 |
T |
|
| Q |
182 |
tttgctgtctgcagattctaaacataattgtgaataattcaaattaatttctggcatagcaaaaagttgtgactagactagtatacatcgattattg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
4600086 |
tttgctgtctgcagattctaaacataattgtgaataattcaaattaatttctggcatagcaaaaagttttgactagactagtatgcatcgattattg |
4599990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 246 times since January 2019
Visitors: 2563